porodówka kalisz 2013 cd

Było to badanie II fazy dotyczące STI571 (obecnie nazywanego mesylanem imatinibu) u pacjentów z zagrażającymi życiu chorobami, o których wiadomo, że są związane z jedną lub większą liczbą kinaz tyrozynowych wrażliwych na STI571. Dwaj opisani tutaj pacjenci są jedynymi dwoma pacjentami z 5q33 anomaliami. Prezentowane tu dane zostały zebrane, zinterpretowane i przeanalizowane przez badaczy akademickich, którzy również napisali artykuł we współpracy z przedstawicielami Novartis. Analiza cytogenetyczna i fluorescencja w hybrydyzacji in situ
Analizę cytogenetyczną komórek szpiku kostnego przeprowadzono konwencjonalnym pasmem G. Dwukolorowa fluorescencyjna hybrydyzacja in situ do przegrupowania PDGFRB została przeprowadzona w Pacjentach 2 i 4 z dwoma flankują- cymi sondami kosmidowymi dla chromosomu 5, 9-4 i 4-1, jak opisano wcześniej5. Oceniano łącznie 100 komórek w interfazie.
Identyfikacja transkryptu fuzyjnego ETV6-PDGFRB
RNA poddano odwrotnej transkrypcji i testowano na fuzję ETV6-PDGFRB przez jednoetapową reakcję łańcuchową polimerazy z odwrotną transkryptazą (RT-PCR) (granica wykrywalności, 10-2) i RT-PCR w warunkach hemi-nested (granica wykrywalności, 10 -5). Przeprowadzono jednoetapową reakcję PCR przez 30 cykli w temperaturze hybrydyzacji 60 ° C z użyciem starterów ETV6-J (TTCACCATTCTTCCACCCTGGA) i PD-F (TTGACGGCCACTTTCATCGT). W przypadku hemi-nested PCR, produkty tej reakcji amplifikowano ze starterami ETV6-J i PD-C (TGGCTTCTTCTGCCAAAGCA) przez 30 cykli w temperaturze hybrydyzacji 64 ° C.
Badania in vitro pod kątem wrażliwości na Imatinib
Próbki krwi obwodowej uzyskano od Pacjentów 2 i 4; komórki z leukapfezy u pięciu pacjentów z przewlekłą białaczką szpikową z chromosomem Philadelphia (Ph) w fazie przewlekłej i komórki z leukapfezy lub szpiku kostnego od trzech zdrowych dawców zastosowano jako kontrole. Wszystkie okazy uzyskano za pisemną lub ustną zgodą dawców. Jednojądrzaste komórki hodowano w pożywce RPMI 1640 uzupełnionej 10% płodową surowicą cielęcą, 2% L-glutaminą i 2% penicyliną-streptomycyną. W tych warunkach (bez dodatkowych cytokin) nie dochodzi do proliferacji ani różnicowania się normalnych lub białaczkowych komórek. Próbki hodowano (1 milion komórek na mililitr) w obecności lub przy braku .m imatinibu i monitorowano przez wybarwienie błękitem trypanowym pod kątem żywotności komórek co dwa dni.
Wyniki
Analiza cytogenetyczna i fluorescencja w hybrydyzacji in situ
Rycina 2. Rycina 2. Dwukolorowa fluorescencja in situ Hybrydyzacja komórek od pacjenta 2 ze schematycznym przedstawieniem chromosomów 5 i 12, wskazująca punkty przerwania t (5; 12) (q33; p13). Komórki w interfazie sondowano dwoma flankują- cymi sondami kosmidowymi dla chromosomu 5, 9-4 i 4-1,5. Ponad 80 procent komórek wykazywało jeden połączony sygnał i oddzielne sygnały czerwone i zielone, co wskazuje na przerwanie genu PDGFRB. Strzałki wskazują punkty przerwania.
Wszystkie komórki szpiku kostnego w metafazie, które badaliśmy z Pacjentów 1, 2 i 3, zawierały translokację t (5; 12) (q33; p13). Przed leczeniem imatynibem 5 z 10 komórek w metafazie od Pacjenta 4 (50 procent) zawierało t (5; 12) (q33; q13). Dwukolorowa fluorescencyjna hybrydyzacja in situ przeprowadzona na komórkach od pacjentów 2 i 4 wykazała jeden połączony sygnał i oddzielne czerwone i zielone sygnały w ponad 80 procentach komórek od każdego pacjenta, wskazując na zaburzenie PDGFRB (Figura 2)
[hasła pokrewne: hipnotyczny sen, perycykl, ile zarabia stomatolog ]
[podobne: epikotyl, budowa wewnętrzna łodygi, typy wiązek przewodzących ]